Biological Sciences Home

Biochemistry
R. Bentley
J. Brodsky
J. Franzen
P. Grabowski
J. Hempel
L. Jen-Jacobson
K. Kiselyov
C. Peebles
J. Rosenberg
A. Schwacha

Cell Biology
J. Brodsky
A. Chung
J. Hildebrand
L. Jacobson
N. Kaufmann
K. Kiselyov
J. Pipas
M.-T. Sáens-Robles
W. Saunders
C. Walsh

Computational Biology
M. Grabe
J. Lawrence
J. Rosenberg

Developmental Biology
G. Campbell
D. Chapman
J. Hildebrand
B. Roman
S. Shostak
B. Stronach
V. Twombly

Ecology
T.-L. Ashman
W. Carson
W. Coffman
S. Kalisz
T. Katzner
R. Relyea
S. Tonsor
B. Traw

Evolution
T.-L. Ashman
A. Bledsoe
S. Kalisz
J. Lawrence
Z.-X. Luo
R. Relyea
S. Shostak
S. Tonsor
B. Traw

Genetics
K. Arndt
T.-L. Ashman
G. Campbell
D. Chapman
G. Hatfull
J. Hildebrand
L. Jacobson
S. Kalisz
J. Martens
V. Oke
W. Saunders
B. Stronach
S. Tonsor
R. Wood

Microbiology
G. Hatfull
R. Hendrix
J. Lawrence
V. Oke
J. Pipas
M. Popa
I. Campbell
R.L. Duda
S. Godfrey

Molecular Biology
K. Arndt
J. Franzen
P. Grabowski
G. Hatfull
R. Hendrix
L. Jen-Jacobson
J. Martens
C. Peebles
J. Pipas
J. Rosenberg
A. Schwacha
C. Walsh

Plant Biology
T.-L. Ashman
W. Carson
S. Kalisz
V. Oke
C. Partanen
S. Tonsor
B. Traw

Science Education
A. Bledsoe
K. Curto
L. Daniels
S. Godfrey
N. Kaufmann
C. LaFave
J. Newman
E. Polinko
M. Popa
L. Roberts
T. Seiflein
R. Sherwin
A. Slinskey Legg

Structural Biology
M. Grabe
J. Hempel
R. Hendrix
L. Jen-Jacobson
J. Rosenberg
A. VanDemark

Former Faculty

 

Publications of Dr. Anthony Schwacha


Bochman, M.L., and A. Schwacha (2008) The Mcm2-7 complex has in vitro helicase activity. Mol. Cell 31:287-293

Helicases unwind duplex DNA ahead of the polymerases at the replication fork. However, the identity of the eukaryotic replicative helicase has been controversial; in vivo studies implicate the ring-shaped heterohexameric Mcm2-7 complex, although only a specific subset of Mcm subunits (Mcm467) unwind DNA in vitro. To address this discrepancy, we have compared both Mcm assemblies and find that they differ in their linear single-stranded DNA association rate and their ability to bind circular single-stranded DNA. These differences depend upon the Mcm2/5 interface, which we hypothesize serves as an ATP-dependent "gate" within Mcm2-7. Importantly, we find that reaction conditions that putatively close the Mcm2-7 "gate" reconstitute Mcm2-7 helicase activity. Unlike Mcm467, Mcm2-7 helicase activity is strongly anion dependent. Our results show that purified Mcm2-7 acts as a helicase, provides functional evidence of a Mcm2/5 gate, and lays the foundation for future mechanistic studies of this critical factor.

Download the PDF Reprint (822 kb)


Bochman, M.L., S.P. Bell, and A. Schwacha (2008) Subunit organization of Mcm2-7 and the unequal role of active sites in ATP hydrolysis and viability. Mol. Cell Biol. 28:5865-5873

The Mcm2-7 (Minichromosome Maintenance) complex is a toroidal AAA(+) ATPase and the putative eukaryotic replicative helicase. Unlike a typical homohexameric helicase, Mcm2-7 contains six distinct, essential, and evolutionarily conserved subunits. Precedence to other AAA(+) proteins suggests that Mcm ATPase active sites are formed combinatorially, with Walker A and B motifs contributed by one subunit and a catalytically essential arginine (arginine finger) contributed by the adjacent subunit. To test this prediction, we used co-purification experiments to identify five distinct and stable Mcm dimer combinations as potential active sites; these subunit associations predict the architecture of the Mcm2-7 complex. Through the use of mutant subunits, we establish that at least three sites are active for ATP hydrolysis and have a canonical AAA(+) configuration. In isolation, these five active site dimers have a wide range of ATPase activities. Using Walker B and arginine finger mutations in defined Mcm subunits, we demonstrate that these sites similarly make differential contributions toward viability and ATP hydrolysis within the intact hexamer. Our conclusions predict a structural discontinuity between Mcm2 and Mcm5, and demonstrate that in contrast to other hexameric helicases the six Mcm2-7 active sites are functionally distinct.

Download the PDF Reprint (849 kb)


Bochman, M.L., and A. Schwacha (2007) Differences in the single-stranded DNA binding activities of MCM2-7 and MCM467: MCM2 and 5 define a slow ATP-dependent step. J. Biol. Chem. 282:33795-33804

The MCM2-7 complex, a hexamer containing six distinct and essential subunits, is postulated to be the eukaryotic replicative DNA helicase. Although all six subunits function at the replication fork, only a specific subcomplex consisting of the MCM4, 6, and 7 subunits (MCM467) and not the MCM2-7 complex exhibits DNA helicase activity in vitro. To understand why MCM2-7 lacks helicase activity, and to address the possible function of the MCM2, 3, and 5 subunits, we have compared the biochemical properties of the Saccharomyces cerevisiae MCM2-7 and MCM467 complexes. We demonstrate that both complexes are toroidal and possess a similar ATP-dependent single-stranded DNA (ssDNA) binding activity, indicating that the lack of helicase activity by MCM2-7 is not due to ineffective ssDNA binding. We identify two important differences between them. MCM467 binds dsDNA better than MCM2-7. In addition, we find that the rate of MCM2-7/ssDNA association is slow compared to MCM467; the association rate can be dramatically increased either by pre-incubation with ATP or by inclusion of mutations that ablate the MCM2/5 active site. We propose that the DNA binding differences between MCM2-7 and MCM467 correspond to a conformational change at the MCM2/5 active site with putative regulatory significance.

Download the PDF Reprint (685 kb)


Schwacha, A., and S.P. Bell (2001) Interactions between two catalytically distinct MCM subgroups are essential for coordinated ATP hydrolysis and DNA replication. Mol. Cell 8:1093-1104

The six MCM (minichromosome maintenance) proteins are essential DNA replication factors that each contain a putative ATP binding motif and together form a heterohexameric complex. We show that these motifs are required for viability in vivo and coordinated ATP hydrolysis in vitro. Mutational analysis discriminates between two functionally distinct MCM protein subgroups: Mcm4p, 6p, and 7p contribute canonical ATP binding motifs essential for catalysis, whereas the related motifs in Mcm2p, 3p, and 5p serve a regulatory function. Reconstitution experiments indicate that specific functional interactions between these two subgroups are required for robust ATP hydrolysis. Our observations show parallels between the MCM complex and the F1-ATPase, and we discuss how ATP hydrolysis by the MCM complex might be coupled to DNA strand separation.

Download the PDF Reprint (807 kb)


Schwacha, A., and N. Kleckner (1997) Interhomolog bias during meiotic recombination: meiotic functions promote a highly differentiated interhomolog-only pathway. Cell 90:1123-1135

Meiotic recombination occurs preferentially between homologous nonsister chromatids rather than between sisters, opposite to the bias of mitotic recombinational repair. We have examined formation of joint molecule recombination intermediates (JMs) between homologs and between sisters in yeast strains lacking the meiotic chromosomal protein Red1, the meiotic recA homolog Dmc1, and/or mitotic recA homolog(s), Rad51, Rad55, and Rad57. Mutant phenotypes imply that most meiotic recombination occurs via an interhomolog-only pathway along which interhomolog bias is established early, prior to or during double strand break (DSB) formation, and then enforced, just at the time when DSBs initiate JM formation. A parallel, less differentiated pathway yields intersister and, probably, a few interhomolog events. Coordinate action of mitotic recA homologs as one functional unit, two functions of RED1, and an interhomolog interaction function of DMC1 are also revealed.

Download the PDF Reprint (508 kb)


Storlazzi, A., L. Xu, A. Schwacha, and N. Kleckner (1996) Synaptonemal complex (SC) component Zip1 plays a role in meiotic recombination independent of SC polymerization along the chromosomes. Proc. Natl. Acad. Sci., USA 93:9043-9048

Zip1 is a yeast synaptonemal complex (SC) central region component and is required for normal meiotic recombination and crossover interference. Physical analysis of meiotic recombination in a zip1 mutant reveals the following: Crossovers appear later than normal and at a reduced level. Noncrossover recombinants, in contrast, seem to appear in two phases: (i) a normal number appear with normal timing and (ii) then additional products appear late, at the same time as crossovers. Also, Holliday junctions are present at unusually late times, presumably as precursors to late-appearing products. Red1 is an axial structure component required for formation of cytologically discernible axial elements and SC and maximal levels of recombination. In a red1 mutant, crossovers and noncrossovers occur at coordinately reduced levels but with normal timing. If Zip1 affected recombination exclusively via SC polymerization, a zip1 mutation should confer no recombination defect in a red1 strain background. But a red1 zip1 double mutant exhibits the sum of the two single mutant phenotypes, including the specific deficit of crossovers seen in a zip1 strain. We infer that Zip1 plays at least one role in recombination that does not involve SC polymerization along the chromosomes. Perhaps some Zip1 molecules act first in or around the sites of recombinational interactions to influence the recombination process and thence nucleate SC formation. We propose that a Zip1-dependent, pre-SC transition early in the recombination reaction is an essential component of meiotic crossover control. A molecular basis for crossover/noncrossover differentiation is also suggested.

Download the PDF Reprint (2.2 MB)


Schwacha, A., and N. Kleckner (1995) Identification of double Holliday junctions as intermediates in meiotic recombination. Cell 83:783-791

During meiosis, branched DNA molecules containing information from both parental chromosomes occur in vivo at loci where meiosis-specific double-stranded breaks occur. We demonstrate here that these joint molecules are recombination intermediates: they contain single strands that have undergone exchange of information. Moreover, these joint molecules are resolved into both parental and recombinant duplexes when treated in vitro with Holliday junction-resolving endonucleases RuvC or T4 endo VII. Taken together with previous observations, these results strongly suggest that joint molecules are double Holliday junctions.

Download the PDF Reprint (1.7 MB)


Schwacha, A., and N. Kleckner (1994) Identification of joint molecules that form frequently between homologs but rarely between sister chromatids during yeast meiosis. Cell 76:51-63

We have investigated DNA interactions between homologs and between sister chromatids during meiosis in S. cerevisiae. We have detected a DNA species containing information from both parental chromosomes at a specific hotspot for meiotic recombination and double strand breaks (DSBs). These joint molecules are a prominent feature of meiotic prophase. They appear to be a major intermediate stage in DSB-promoted recombination, because they occur with appropriate timing and require known recombination functions. Other possibilities cannot be completely dismissed, however. Most or all joint molecules contain two full-length nonrecombinant strands from each parental duplex and thus do not consist of single Holliday junctions. Joint molecules form between sister chromatids at approximately 10% the interhomolog level. Also, joint molecule formation is aberrant in a mutant defective in the HOP1 gene, which encodes a meiotic chromosome structure component. General models for discrimination between homologs and sisters during meiosis are discussed.

Download the PDF Reprint (3.5 MB)


Osuna, R., A. Schwacha, and R.A. Bender (1994) Identification of the hutUH operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis. J. Bacteriol. 176:5525-5529

Expression of Klebsiella aerogenes histidine utilization operons hutUH and hutIG is negatively regulated by the product of hutC. Multiple copies of the hutUH promoter region [hut(P)] present in trans were able to titrate the limited amount of host-encoded hut repressor (HutC). Thus, the hut(P) region contains a specific binding site for HutC. To identify DNA sequences required for HutC titration, we constructed and characterized a set of 40 left-entering and 28 right-entering deletions within a 250-bp DNA sequence containing the hut(P) region. Mutants carrying deletions that altered a unique dyad symmetric sequence, ATGCTTGTATAGACAAGTAT, from -11 to -30 relative to the hutUH promoter (hutUp) were unable to titrate hut repressor; mutants carrying deletions that left this sequence intact retained their ability to titrate hut repressor. Thus, we identify ATGCTTGT ACAAGTAT as the hutUH operator.

Download the PDF Reprint (908 kb)


Schwacha, A., and R.A. Bender (1993) The nac (nitrogen assimilation control) gene from Klebsiella aerogenes. J. Bacteriol. 175:2107-2115

The Klebsiella aerogenes nac gene, whose product is necessary for nitrogen regulation of a number of operons, was identified and its DNA sequence determined. The nac sequence predicted a protein a 305 amino acids with a strong similarity to members of the LysR family of regulatory proteins, especially OxyR from Escherichia coli. Analysis of proteins expressed in minicells showed that nac is a single-gene operon whose product has an apparent molecular weight of about 32 kDa as measured in sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Immediately downstream from nac is a two-gene operon, the first gene of which encodes another member of the LysR family. Upstream from nac is a tRNAAsn gene transcribed divergently from nac. About 60 bp upstream from the nac open reading frame lies a sequence nearly identical to the consensus for sigma 54-dependent promoters, with the conserved GG and GC nucleotides at -26 and -14 relative to the start of transcription. About 130 bp farther upstream (at -153 relative to the start of transcription) is a sequence nearly identical to the transcriptional activator NTRC-responsive enhancer consensus. Another weaker NTRC-binding site is located adjacent to this site (at -133 relative to the start of transcription). Thus, we propose that nac is transcribed by RNA polymerase carrying sigma 54 in response to the nitrogen regulatory (NTR) system. A transposon located between the promoter and the nac ORF prevented NTR-mediated expression of nac, supporting this identification of the promoter sequence.

Download the PDF Reprint (2.0 MB)


Schwacha, A., and R.A. Bender (1993) The product of the Klebsiella aerogenes nac (nitrogen assimilation control) gene is sufficient for activation of the hut operons and repression of the gdh operon. J. Bacteriol. 175:2116-2124

In Klebsiella aerogenes, the formation of a large number of enzymes responds to the quality and quantity of the nitrogen source provided in the growth medium, and this regulation requires the action of the nitrogen regulatory (NTR) system in every case known. Nitrogen regulation of several operons requires not only the NTR system, but also NAC, the product of the nac gene, raising the question of whether the role of NAC is to activate operons directly or by modifying the specificity of the NTR system. We isolated an insertion of the transposon Tn5tac1 which puts nac gene expression under the control of the IPTG-inducible tac promoter rather than the nitrogen-responsive nac promoter. When IPTG was present, cells carrying the tac-nac fusion activated NAC-dependent operons and repressed NAC-repressible operons independent of the nitrogen supply and even in the absence of an active NTR system. Thus, NAC is sufficient to regulate operons like hut (encoding histidase) and gdh (encoding glutamate dehydrogenase), confirming the model that the NTR system activates nac expression and NAC activates hut and represses gdh. Activation of urease formation occurred at a lower level of NAC than that required for glutamate dehydrogenase repression, and activation of histidase formation required still more NAC.

Download the PDF Reprint (1.8 MB)


Schwacha, A., and R.A. Bender (1990) Nucleotide sequence of the gene encoding the repressor for the histidine utilization genes of Klebsiella aerogenes. J. Bacteriol. 172:5477-5481

The hutC gene of Klebsiella aerogenes encodes a repressor that regulates expression of the histidine utilization (hut) operons. The DNA sequence of a region known to contain hutC was determined and shown to contain two long rightward-reading open reading frames (ORFs). One of these ORFs was identified as the 3' portion of the hutG gene. The other ORF was the hutC gene. The repressor predicted from the hutC sequence contained a helix-turn-helix motif strongly similar to that seen in other DNA-binding proteins, such as lac repressor and the catabolite gene activator protein. This motif was located in the N-terminal portion of the protein, and this portion of the protein seemed to be sufficient to allow repression of the hutUH operon but insufficient to allow interaction with the inducer. The presence of a promoterlike sequence and a ribosome-binding site immediately upstream of the hutC gene explained the earlier observation that hutC can be transcribed independently of the other hut operon genes. The predicted amino acid sequence of hut repressor strongly resembled that of the corresponding protein from Pseudomonas putida (S. L. Allison and A. T. Phillips, J. Bacteriol. 172:5470-5476, 1990). An unexpected, leftward-reading ORF extending from about the middle of hutC into the preceding (hutG) gene was also detected. The deduced amino acid sequence of this leftward ORF was quite distinct from that of an unexpected ORF of similar size found immediately downstream of the P. putida hutC gene.

Download the PDF Reprint (1.1 MB)


Schwacha, A., J.A. Cohen, K.B. Gehring, and R.A. Bender (1990) Tn1000-mediated insertion mutagenesis of the histidine utilization (hut) gene cluster from Klebsiella aerogenes: genetic analysis of hut and unusual target specificity of Tn1000. J. Bacteriol. 172:5991-5998

The histidine utilization (hut) genes from Klebsiella aerogenes were cloned in both orientations into the HindIII site of plasmid pBR325, and the two resulting plasmids, pCB120 and pCB121, were subjected to mutagenesis with Tn1000. The insertion sites of Tn1000 into pCB121 were evenly distributed throughout the plasmid, but the insertion sites into pCB120 were not. There was a large excess of Tn1000 insertions in the "plus" or g-d orientation in a small, ca. 3.5-kilobase region of the plasmid. Genetic analysis of the Tn1000 insertions in pCB120 and pCB121 showed that the hutUH genes form an operon transcribed from hutU and that the hutC gene (encoding the hut-specific repressor) is independently transcribed from its own promoter. The hutIG cluster appears not to form an operon. Curiously, insertions in hutI gave two different phenotypes in complementation tests against hutG504, suggesting either that hutI contains two functionally distinct domains or that there may be another undefined locus within the hut cluster. The set of Tn1000 insertions allowed an assignment of the gene boundaries within the hut cluster, and minicell analysis of the polypeptides expressed from plasmids carrying insertions in the hut genes showed that the hutI, hutG, hutU, and hutH genes encode polypeptides of 43, 33, 57, and 54 kilodaltons, respectively.

Download the PDF Reprint (1.6 MB)


Oriel, P., and A. Schwacha (1988) Growth on starch and extracellular production of thermostable amylase by Escherichia coli. Enzyme Microb. Tech. 10:42-46

 
This Site is maintained by the Bioscience Webmaster; this page was last modified 9/12/2009